Journal: Neural Regeneration Research

Article Title: Small molecule inhibitor DDQ-treated hippocampal neuronal cells show improved neurite outgrowth and synaptic branching

doi: 10.4103/NRR.NRR-D-24-00157

Figure Lengend Snippet: Antibodies used in immunofluorescence analysis

Article Snippet: VAChT , Rabbit polyclonal 1:200 , ACT-003-200UL , Alomone Labs Jerusalem BioPark (JBP) Jerusalem, Israel , , Goat-anti-rabbit Alexa Fluor488 1:400 , A-11008 , Thermo Fisher Scientific.

Techniques: Immunofluorescence

Journal: ACS Omega

Article Title: Early Exposure of an Infantile Rat to Sex-Related Content Induces Precocious Puberty by Activation of Cholinergic Neurons in the Amygdala and KNDy Neurons in the Arcuate Nucleus

doi: 10.1021/acsomega.5c01531

Figure Lengend Snippet: Excited cholinergic neurons in the amygdala by odor and visual temptation. (A) Immunofluorescence shows the expression of kisspeptin (green) and VAChT (red) at ARC in different groups. Bar scale: 500 and 10 μm. The right panel is the enlarged view of the white framed area on the left. (B) Immunofluorescence shows the expression of ChAT (red) at MeA of amygdala in different groups. The right panel is the enlarged views of the white framed area on the left. Bar scale: 500 μm, 10 μm. (C) Statistical analysis of the differences in the number of ChAT-positive cell bodies in MeA among different groups by one-way ANOVA. KP, kisspeptin; VAChT, vesicular acetylcholine transporter; and ChAT, choline acetyltransferase. Refer to the legend of and for the meaning of the other abbreviations.

Article Snippet: The first group was raised normally without any treatment (negative control, NC), the second group was provided with sawdust from the cage housing sexually experienced male rats (Odor temptation, OT), the third group was kept in cages fully covered with the color photographs of the rats displaying sexual behaviors at outer wall (Visual temptation, VT), the fourth group was kept both in OT and VT (OVT), the fifth group was OVT adding 50 mmol of choline acetyltransferase (ChAT) inhibitor (α-NETA, Cat. No. ab144314, Abcam) using stereotactic injection, and the sixth group was OVT adding 20 mmol of vesicular acetylcholine transporter (VAChT) inhibitor (vesamicol, Cat. No. HY-113995, MedChemExpress, China) using stereotactic injection.

Techniques: Immunofluorescence, Expressing

Journal: STAR Protocols

Article Title: Protocol to derive postganglionic parasympathetic neurons using human pluripotent stem cells for electrophysiological and functional assessment

doi: 10.1016/j.xpro.2025.104001

Figure Lengend Snippet: Markers for human pluripotent stem cell-derived parasympathetic neurons (A) Expression of ChAT, VAChT, CHRNB4, and NPY2R by immunofluorescence for d30 parasympathetic neurons derived from either spheroid plating (top) or dissociated plating (bottom). (B) Gene expression of d30 parasympathetic neuron markers ( ASCL1, PHOX2B, PRPH, CHRNA3, ChAT, VAChT, NPY2R ) by RT-qPCR derived either through spheroid plating (left) or dissociated plating (right). n= 5 biological replicates.

Article Snippet: Primer: VAChT F: GCTGTTTGCTTCCAAGGCTATCC R: GAAGGCGAACAGGACTGTAGAG , OriGene , HP206648.

Techniques: Derivative Assay, Expressing, Immunofluorescence, Gene Expression, Quantitative RT-PCR

Journal: Neural Regeneration Research

Article Title: Small molecule inhibitor DDQ-treated hippocampal neuronal cells show improved neurite outgrowth and synaptic branching

doi: 10.4103/NRR.NRR-D-24-00157

Figure Lengend Snippet: Antibodies used in immunofluorescence analysis

Article Snippet: VAChT , Rabbit polyclonal 1:200 , ACT-003-200UL , Alomone Labs Jerusalem BioPark (JBP) Jerusalem, Israel , , Goat-anti-rabbit Alexa Fluor488 1:400 , A-11008 , Thermo Fisher Scientific.

Techniques: Immunofluorescence

Journal: Cell reports

Article Title: Spinal microcircuits go through multiphasic homeostatic compensations in a mouse model of motoneuron degeneration

doi: 10.1016/j.celrep.2024.115046

Figure Lengend Snippet: KEY RESOURCES TABLE

Article Snippet: Rat Anti-vesicular acetylcholine transporter , Synaptic Systems , Cat# 139 017, RRID:AB_2905597.

Techniques: Software, Microscopy